| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.005720 |
| Chromosome: | chromosome 4 |
| Location: | 2372402 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g221200 | CGL109 | Conserved in the Green Lineage; (1 of 1) IPR001005//IPR001965//IPR009057//IPR011011//IPR013083//IPR017877 - SANT/Myb domain // Zinc finger, PHD-type // Homeodomain-like // Zinc finger, FYVE/PHD-type // Zinc finger, RING/FYVE/PHD-type // Myb-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGGAGAGCACAAGGGAGGGAAGCGTGTGCGTGCGGCCGTGTCTACC |
| Internal bar code: | GGCCGAACTCGCGTATCCAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2963 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTCACTGGTTGTACTGCT |
| Suggested primer 2: | GCCTAGGCCATTGCTCGTAT |