Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.005763 |
Chromosome: | chromosome 14 |
Location: | 1382506 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g616900 | SULP2,SLP2 | Chloroplast sulfate permease; (1 of 1) K02047 - sulfate transport system permease protein (cysW) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGCGGGGATAACACCCTCTGTCCCCATTGCGGCGTGTTGGCTAGTCTT |
Internal bar code: | GCCGGAGAGAGTAATACAAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1546 |
LEAP-Seq percent confirming: | 80.6452 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTTGTACTCCTGCGTGGA |
Suggested primer 2: | TGCTTTGTGACGTTTCAGCG |