| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.005763 |
| Chromosome: | chromosome 14 |
| Location: | 1382506 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616900 | SULP2,SLP2 | Chloroplast sulfate permease; (1 of 1) K02047 - sulfate transport system permease protein (cysW) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGCGGGGATAACACCCTCTGTCCCCATTGCGGCGTGTTGGCTAGTCTT |
| Internal bar code: | GCCGGAGAGAGTAATACAAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1546 |
| LEAP-Seq percent confirming: | 80.6452 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTGTACTCCTGCGTGGA |
| Suggested primer 2: | TGCTTTGTGACGTTTCAGCG |