| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.005786 |
| Chromosome: | chromosome 11 |
| Location: | 4182999 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g481450 | ATPG1,ATPG | Chloroplast ATP synthase subunit II; (1 of 2) K02109 - F-type H+-transporting ATPase subunit b (ATPF0B, atpF) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACTGACCCCCAGGTGCAAGGATAACCACGCGCAAGCGCGGAGCTTACA |
| Internal bar code: | AGAGTATGCATGCCCGTGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1329 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGCGCGATAACCTCATCC |
| Suggested primer 2: | CTTTTCGCTGAAGGGTGTGC |