Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.005812 |
Chromosome: | chromosome 12 |
Location: | 9725617 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554103 | CGL74 | (1 of 1) PTHR26312//PTHR26312:SF0 - FAMILY NOT NAMED // TETRATRICOPEPTIDE REPEAT PROTEIN 5; conserved expressed TPR repeat protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCATGCCCTCCCCTCCCACTGACCTCCAAATACCCCCCTACCTCACAC |
Internal bar code: | GTGCCGAGTTATTGTATTTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 487 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCCCAGACATAGATGCC |
Suggested primer 2: | GCCATGACGCACGATTACAC |