| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.005833 |
| Chromosome: | chromosome 12 |
| Location: | 4997089 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525100 | SMC6B | (1 of 2) PTHR19306//PTHR19306:SF6 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // PROTEIN C23H4.6, ISOFORM A-RELATED; Structural Maintenance of Chromosomes protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCACGAGAATGAATTGTGCCTTGCCGGTTGGGCTTGATTGTGGCTAT |
| Internal bar code: | ATCAATTATTCTATTCTGCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1058 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGATGTCAAGTGTGGATGC |
| Suggested primer 2: | TTGCATCGCAGTCCAGTCTT |