Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.005844 |
Chromosome: | chromosome 17 |
Location: | 886834 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g702500 | TAB2 | (1 of 1) PTHR34556//PTHR34556:SF2 - FAMILY NOT NAMED // F17A17.35 PROTEIN; conserved chloroplast PsaB RNA binding protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTTCGCTGGTATTGAACGCCTTCATCCTACTATCCGGCCACCCAGCCG |
Internal bar code: | CCTGCCCTAATCCTGATCACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 903 |
LEAP-Seq percent confirming: | 4.54545 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAAGTCAGCCACCGTGACC |
Suggested primer 2: | CCATAACCCTACCCCTCCCA |