Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.005919 |
Chromosome: | chromosome 9 |
Location: | 6525794 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g415750 | MFT8 | General substrate transporter, major facilitator superfamily; (1 of 2) PTHR23518//PTHR23518:SF2 - FAMILY NOT NAMED // MULTIDRUG RESISTANCE PROTEIN MDTH | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAGAGGGGCACTTTCATTCTCTACCAAAGCGGCCGATCCGTGCAGCC |
Internal bar code: | TTGGGGTCGTGGGCTAGAGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4407 |
LEAP-Seq percent confirming: | 73.3333 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATACCGTCATGGCCGTCAC |
Suggested primer 2: | CACCGGGCAGTTGAATACCT |