| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.005953 |
| Chromosome: | chromosome 6 |
| Location: | 2762820 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g271200 | PNO1 | (1 of 1) 1.6.3.3 - NADH oxidase (H(2)O(2)-forming) / H(2)O(2)-forming NADH oxidase; Pyridine nucleotide-disulphide oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCAGTGACCCAGCCATCTTCGCCGTGGGAGACGCCGTAGAGGTGGGG |
| Internal bar code: | TCGACTATGGATAGGAGGACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 332 |
| LEAP-Seq percent confirming: | 6.89655 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCGTTGCAAGGATGTTTG |
| Suggested primer 2: | CTTCCTCCGAATCGCTCTCC |