| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.005956 |
| Chromosome: | chromosome 6 |
| Location: | 2578934 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269752 | TRXm,TRXM1,TRX15 | (1 of 1) IPR000104//IPR005746//IPR012336//IPR013766 - Antifreeze protein, type I // Thioredoxin // Thioredoxin-like fold // Thioredoxin domain; Thioredoxin m, chloroplastic | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGAACCCTAGCAAGCGCCTGCACCAAACCCTAACACCCGAGCTCGCCTG |
| Internal bar code: | GCGCTATGACTTGTATATCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2116 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAGCCCTAACCCACTCTG |
| Suggested primer 2: | GGTTTGTAGTCCCCACCCTG |