| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.005988 |
| Chromosome: | chromosome 2 |
| Location: | 1054431 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g080250 | YGG1,CGL97,YLMG1 | Conserved in the green lineage 97; (1 of 4) PF02325 - YGGT family (YGGT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCCTGATCAAAATCTATTTCCATTTCCTGCACACCACCTATCTGTGCC |
| Internal bar code: | ATCAGCGCCTACCGCGGCGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 847 |
| LEAP-Seq percent confirming: | 46.6667 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTGCCCGATCCTTTCTT |
| Suggested primer 2: | GAGTGGTGCTCTACTACGCC |