| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.005998 |
| Chromosome: | chromosome 10 |
| Location: | 6420514 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464600 | CAM14,EZY15 | (1 of 1) IPR002048//IPR006311 - EF-hand domain // Twin-arginine translocation pathway, signal sequence; Calmodulin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAGGGTGTGTGATGGGACAGGGTTCAAGGCAGGTTGGCGAGGTCCCGT |
| Internal bar code: | GAATCTATGAGGAATACTGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3030 |
| LEAP-Seq percent confirming: | 94.6429 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCAGCATGTAGGTTTCCT |
| Suggested primer 2: | AACGGTCAGATGAGGGCTTG |