| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.006000 |
| Chromosome: | chromosome 3 |
| Location: | 6654186 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g195200 | HLD1,CGL76 | Conserved in the Green Lineage; (1 of 6) IPR000073//IPR000639//IPR029058 - Alpha/beta hydrolase fold-1 // Epoxide hydrolase-like // Alpha/Beta hydrolase fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCCCATGCAGAACAGCAGAAGCCGTTGCAGCTGCCAGTCGAACACAT |
| Internal bar code: | TGCGCATAGACCCACGGCCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 60 |
| LEAP-Seq percent confirming: | 2.94118 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCGGTGATGAAGTGGCTG |
| Suggested primer 2: | CTTTTTCACTGCGGCGTTCA |