| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006008 |
| Chromosome: | chromosome 6 |
| Location: | 2321854 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267600 | LCYE,LEC1,LCYE1 | (1 of 1) 5.5.1.18 - Lycopene epsilon-cyclase; lycopene epsilon cyclase, chloroplast precursor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAGACGCTTCCAGTCAGGCGCCAAACCAAACAAAAATGCTTCACCAG |
| Internal bar code: | GCCGGTTGGTCCGGCCGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1769 |
| LEAP-Seq percent confirming: | 63.6364 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTTGGGGCGCGTTCAATT |
| Suggested primer 2: | CTGTGGTAAAGGGAGGGCAG |