Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.006030 |
Chromosome: | chromosome 12 |
Location: | 94824 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g483950 | MDN4,MDH4 | (1 of 3) K00026 - malate dehydrogenase (MDH2); Malate dehydrogenase 4 | 3'UTR |
Cre12.g484000 | BCX1,ACX1 | Beta-carboxyltransferase (ACCase complex); (1 of 1) K01963 - acetyl-CoA carboxylase carboxyl transferase subunit beta (accD) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACAATGACAAGGTAGCCCACCCAAGGTGGCCTGTTTGCCAAACAATC |
Internal bar code: | CTATGGCCAATTGCGCACTCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3336 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 82 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGAGAAGGGTGTGCAGTTC |
Suggested primer 2: | GTATACAGGGCGTGGAGTCG |