Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.006047 |
Chromosome: | chromosome 3 |
Location: | 636459 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g145587 | CPLD1 | Conserved in the Plant Lineage and Diatoms; (1 of 4) PF04134 - Protein of unknown function, DUF393 (DUF393) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGAACCCTCGCCCCTGCCCCCAACCGCGCCCCTGCCCCAACTTGCTT |
Internal bar code: | AAATTGTCCTTCGCTGCTCAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 440 |
LEAP-Seq percent confirming: | 15.625 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACATTAGCACTTCGCCAG |
Suggested primer 2: | CGTTTTGCACTTGGCCATGA |