| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006061 |
| Chromosome: | chromosome 9 |
| Location: | 2708758 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391650 | HCP4 | (1 of 4) 1.7.99.1 - Hydroxylamine reductase / Hydroxylamine (acceptor) reductase; Hybrid-cluster protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGAGCAACGCGCACACCGACACCTTCGGCCACCCCGTGCCCACGCCC |
| Internal bar code: | CCTTGTATGGAACTTGGCCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1965 |
| LEAP-Seq percent confirming: | 41.6667 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACTTGGGTTGCAGGCCTC |
| Suggested primer 2: | ATCTACTCGGTCAAGGGCCT |