| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006086 |
| Chromosome: | chromosome 3 |
| Location: | 5416093 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183850 | FDX6 | (1 of 1) IPR001041//IPR010241//IPR012675 - 2Fe-2S ferredoxin-type iron-sulfur binding domain // Ferredoxin [2Fe-2S], plant // Beta-grasp domain; Apoferredoxin, chloroplast precursor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCAACCCAGTCCTGATGAGGTCAAAGGTCAATGGTTCAGTCACATAG |
| Internal bar code: | TCTTGCACTGGGAACTTAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2652 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACACTTGAGCGACCAGG |
| Suggested primer 2: | GGCCATTAGACGACCCTACG |