| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.006131 |
| Chromosome: | chromosome 1 |
| Location: | 6911953 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049600 | CGLD22 | (1 of 1) K02116 - ATP synthase protein I (atpI); Assembly factor for chloroplast ATPase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGACAAGCAGGGGCACAAACAGGGCGAGGCAAGGCAGAAGAGGGCGC |
| Internal bar code: | CACTTCGTATACGATTGCAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 389 |
| LEAP-Seq percent confirming: | 30.4348 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGCATGTGTTGAATGTGG |
| Suggested primer 2: | AACGCTCCTATCGGCTAAGC |