| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.006152 |
| Chromosome: | chromosome 1 |
| Location: | 4691021 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032500 | DNJ8,TPR2 | Tetratricopeptide-repeat protein 2; (1 of 1) K09523 - DnaJ homolog subfamily C member 3 (DNAJC3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAAGTTATGGGGTTGCCTTAGACGCCGGCTTTTTGGCAAGCAGCCTCG |
| Internal bar code: | TTCTCCGAAACGTCAAGTCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 360 |
| LEAP-Seq percent confirming: | 3.7037 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACCTGCACAAACTCG |
| Suggested primer 2: | GACTCGGTAGCGCGTATTGA |