Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.006182 |
Chromosome: | chromosome 10 |
Location: | 1715210 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429880 | CGL156 | DNA binding protein; (1 of 1) IPR001606//IPR001965//IPR003754//IPR011011//IPR019787 - ARID DNA-binding domain // Zinc finger, PHD-type // Tetrapyrrole biosynthesis, uroporphyrinogen III synthase // Zinc finger, FYVE/PHD-type // Zinc finger, PHD-finger | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCATGTAGCCAGCTGGTCACCAGCGTGACGCCCCATGATTTGATTTAA |
Internal bar code: | CCTGTACCCGTCGTCGAGTACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2790 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCTGCGTGTAGTCCTTGT |
Suggested primer 2: | TTACCAGCACGTACACACCC |