| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006193 |
| Chromosome: | chromosome 6 |
| Location: | 2827634 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g271950 | CGL135,GC6 | (1 of 1) PTHR10013 - GENERAL VESICULAR TRANSPORT FACTOR P115; Conserved in the green lineage 135 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCATGTCAGAAGCGGACTTGCACCGGCAAGCGGAGCGAGCTTTCTGC |
| Internal bar code: | GCTTGGCGTAGCCACGTCGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 266 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGGTTGCTCAAGTTCCG |
| Suggested primer 2: | TTGCAATGGACATTTGGCGG |