Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.006195 |
Chromosome: | chromosome 16 |
Location: | 4840198 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g687300 | CPLD61 | Conserved in the Plant Lineage and Diatoms; (1 of 3) PF13599 - Pentapeptide repeats (9 copies) (Pentapeptide_4) | 5'UTR |
Cre16.g687350 | ACO3,ACX3 | (1 of 1) PTHR10909:SF11 - ACYL-COENZYME A OXIDASE-LIKE PROTEIN; Acyl-CoA oxidase/dehydrogenase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATATGGTAGCTGGGAGGCGTCCAGCTGAGGACATTCGGCACCCGCAATG |
Internal bar code: | CTGTGTATGATCTCGGAATTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1048 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGTGGTGAAGAAAGCGGA |
Suggested primer 2: | TACAGGTGTGGTACGTTGGC |