| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006248 |
| Chromosome: | chromosome 1 |
| Location: | 4542070 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031100 | MET1,TEF30 | Thylakoid enriched fraction, 30-kDa protein; (1 of 3) PTHR17130//PTHR17130:SF24 - MITOCHONDRIAL OUTER MEMBRANE PROTEIN 25 // GAN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACTGGGATGAAGGCACTACATGCAACCCGCCTTGTTAATCGTGATTT |
| Internal bar code: | AGGACTGGGTTAGCCTTCCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 876 |
| LEAP-Seq percent confirming: | 1.53846 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACATCCCTTGCGCTTCAT |
| Suggested primer 2: | TGCAGGCATTTGCTGTTGAC |