| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.006268 |
| Chromosome: | chromosome 3 |
| Location: | 3417966 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166750 | PTK3 | (1 of 6) IPR000719//IPR001245//IPR002290//IPR011009//IPR020635//IPR027916 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa; Putative tyrosine kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGAGGCGGGGTGGCGGTGATGCCCGCTATGCCCGAAGGAAGTGCGCGC |
| Internal bar code: | CAAAAGCTGTTTTGTGATTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2579 |
| LEAP-Seq percent confirming: | 87.8049 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGTCACAGATCTCCGACT |
| Suggested primer 2: | CTGACACACTGCCATCCACT |