| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006299 |
| Chromosome: | chromosome 4 |
| Location: | 1609720 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g213100 | CGLD7 | conserved, expressed esterase / lipase / thioesterase family protein; (1 of 1) 3.1.1.2 - Arylesterase / Paraoxonase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGACTGCGGCACGGAGCATAGGAAACCGGCGCCGGACAGCGGCGCGA |
| Internal bar code: | TCGTGGGGGAGAGTTACAGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2268 |
| LEAP-Seq percent confirming: | 12.1212 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCCCATCAACCCCATCT |
| Suggested primer 2: | GGAGGGGGATGGGTTGAAAG |