| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006314 |
| Chromosome: | chromosome 6 |
| Location: | 2884187 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g272650 | LHCA8 | Light-harvesting protein of photosystem I; (1 of 3) K08911 - light-harvesting complex I chlorophyll a/b binding protein 5 (LHCA5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAGCAGGGACAGAACGCATATAGATCACAGCCAGGTTACAGGAGGA |
| Internal bar code: | CGCGGTAACTGAGGCAGCGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2675 |
| LEAP-Seq percent confirming: | 4.91803 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGTCCCTACGTGTTCC |
| Suggested primer 2: | GAGGGTTTGCAGCAAAGTCG |