| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.006337 |
| Chromosome: | chromosome 2 |
| Location: | 2558176 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092550 | TPR1 | (1 of 1) 6.2.1.4 - Succinate--CoA ligase (GDP-forming) / Succinyl-CoA synthetase (GDP-forming); Tetratricopeptide-repeat protein 1 | 5'UTR |
| Cre02.g092600 | CPX2 | Coproporphyrinogen III oxidase; (1 of 1) PTHR10755//PTHR10755:SF3 - COPROPORPHYRINOGEN III OXIDASE, MITOCHONDRIAL // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTTAGAGCAAACAAGGATGCCTATGGGCAGAACTGGCAAAATGCGCTG |
| Internal bar code: | ATGGGGACGGGTGGAAGGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1659 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAACAAACTTCCGCTCGC |
| Suggested primer 2: | GGGGTCATTTTCCTCTGGGG |