| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.006348 |
| Chromosome: | chromosome 16 |
| Location: | 2997011 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663800 | TPT25,CGL51 | Conserved in the Green Lineage; (1 of 1) PTHR11132:SF88 - XYLULOSE 5-PHOSPHATE/PHOSPHATE TRANSLOCATOR, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCAAACGCCAGCAAGTGCCGCTTTGGCAAGCCCCGCTTGTTCCCTTTC |
| Internal bar code: | ACAGAAGTTTAAGTATTTGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1321 |
| LEAP-Seq percent confirming: | 74.6269 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCGTGTTCATCTTCTGCT |
| Suggested primer 2: | CAACCCCACAAACAGCCATG |