| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006399 |
| Chromosome: | chromosome 9 |
| Location: | 4553915 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401182 | CGL153 | predicted protein; (1 of 1) K14575 - AAA family ATPase (AFG2, DRG1, SPATA5) | outside_mRNA |
| Cre09.g401219 | (1 of 1) IPR000210//IPR011041//IPR011333 - BTB/POZ domain // Soluble quinoprotein glucose/sorbosone dehydrogenase // POZ domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGCTCGTGTGCCGGTGATGTTACTGTTGTCACTCAGCCCCTGCCGCC |
| Internal bar code: | GCTAGTTCTTTTATTAAGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 585 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGGCCTGTCATTCTCT |
| Suggested primer 2: | TTGATGCAATGCGCGATGAG |