| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006403 |
| Chromosome: | chromosome 16 |
| Location: | 4603457 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670950 | CYC4 | c-type cytochrome, chloroplast precursor; (1 of 1) PTHR34688//PTHR34688:SF1 - FAMILY NOT NAMED // CYTOCHROME C6, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACATGAACGGCGGGAACATTCTGGCAGTAGGCGCCACCCTTTTCTC |
| Internal bar code: | GGCAGGTGCGAGTCTCCTGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1516 |
| LEAP-Seq percent confirming: | 62.2642 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACCTCCTCATCGCTCAGA |
| Suggested primer 2: | GAGTATACAGGGGTCGCTGC |