| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.006428 |
| Chromosome: | chromosome 16 |
| Location: | 4760483 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687900 | LHCA7 | Light-harvesting protein of photosystem I; (1 of 3) K08911 - light-harvesting complex I chlorophyll a/b binding protein 5 (LHCA5) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACAAGGTGCCAGTATGATCAGGTATTGATTATCAATTTGCGATCATG |
| Internal bar code: | AACGACATATCGACCTGGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 78 |
| LEAP-Seq percent confirming: | 57.1429 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGTGTGGATCTTCTGCG |
| Suggested primer 2: | GCTGCTTGAAAGATAGCGCC |