| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.006431 |
| Chromosome: | chromosome 10 |
| Location: | 6422667 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464600 | CAM14,EZY15 | (1 of 1) IPR002048//IPR006311 - EF-hand domain // Twin-arginine translocation pathway, signal sequence; Calmodulin-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGATCTGGTGAAGCCGCTGGTTGTGTCCATGGATGCCAACGGCGACG |
| Internal bar code: | TTGGGGAGGTGAAGGAACTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 632 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCGGGCATGCATCATG |
| Suggested primer 2: | TCCCCCGCTTCTCCTGATAA |