| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006439 |
| Chromosome: | chromosome 4 |
| Location: | 3676263 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228900 | PPP19 | (1 of 1) K17618 - ubiquitin-like domain-containing CTD phosphatase 1 [EC:3.1.3.16] (UBLCP1); Phosphoprotein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGTGATCGTGTATCCGGACAACCCGTAGTTGCTAGTGCCAGGGGCGCA |
| Internal bar code: | TGGTGCCAACATCATATTGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3846 |
| LEAP-Seq percent confirming: | 94.3662 |
| LEAP-Seq n confirming: | 134 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 142 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCAGACTCGTTCCCTTTC |
| Suggested primer 2: | CACGTGTCATACCCTGGGAC |