| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.006440 |
| Chromosome: | chromosome 3 |
| Location: | 3856317 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g170300 | SUB5 | (1 of 1) 3.4.24.30 - Coccolysin / Streptococcus thermophilus intracellular proteinase; Subtilisin-like protease | 3'UTR |
| Cre03.g170350 | SEC12 | (1 of 1) PTHR23284:SF0 - PROLACTIN REGULATORY ELEMENT-BINDING PROTEIN; regulator of COP-II vesicle coat | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATCTGTAAGTCCGGATCTGGATTCCGATTGCCCTTGGCGTTGAAGAG |
| Internal bar code: | GGCGGTCATGATCGCATCTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1659 |
| LEAP-Seq percent confirming: | 97.561 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAAGGTGGAGGTGTGCGT |
| Suggested primer 2: | GTTTTGGCAACTCCGCATGT |