Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.006509 |
Chromosome: | chromosome 16 |
Location: | 7554797 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683483 | REX1-B,REX1B | (1 of 1) PF14966 - DNA repair REX1-B (DNA_repr_REX1B); DNA repair protein and protein of unknown function | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGATGCCTGCATTCGCAAGATCAATGACGCCCTAGGTAAGCAGGCAAC |
Internal bar code: | TTGAGCACAGATCGGGTAACTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2164 |
LEAP-Seq percent confirming: | 95.4545 |
LEAP-Seq n confirming: | 42 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTTCACTCCCGACAGGCTG |
Suggested primer 2: | GCAATCCTCCACGACACTCA |