| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006634 |
| Chromosome: | chromosome 9 |
| Location: | 3121226 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394251 | PF16 | Central pair associated protein; (1 of 1) PF00514//PF13513 - Armadillo/beta-catenin-like repeat (Arm) // HEAT-like repeat (HEAT_EZ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCGCTTATCCTTGCTCGGCCATGGTCCACCTCCCCAACCTCATCCGT |
| Internal bar code: | CGGGGACGAATTGTGTCGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3639 |
| LEAP-Seq percent confirming: | 89.5833 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGCATGCAGGAGTAAATGC |
| Suggested primer 2: | CGCTAGTTACCTGCCTCGAG |