| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.006683 |
| Chromosome: | chromosome 1 |
| Location: | 2181020 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012200 | (1 of 3) PF00651//PF03110 - BTB/POZ domain (BTB) // SBP domain (SBP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCATGTCTACATACGACGATTATATTTCAGTACCAGTTTGGCCAACTGC |
| Internal bar code: | TTGGTTCGCGCGAATCGGAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3801 |
| LEAP-Seq percent confirming: | 93.2773 |
| LEAP-Seq n confirming: | 111 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 119 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACCCCTTTGAAAGTCCGA |
| Suggested primer 2: | AGGTACATGCAGCAGGTGTC |