| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.006703 |
| Chromosome: | chromosome 13 |
| Location: | 1696974 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574150 | FAO10 | FAD-dependent oxidoreductase; (1 of 1) 1.1.99.2 - L-2-hydroxyglutarate dehydrogenase / L-alpha-hydroxyglutarate dehydrogenase | 3'UTR |
| Cre13.g574200 | PAP2 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 2 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAATTGGTAACGGCAGCCTGGGGGCTTTAAGAGGAATCCAGTGGCCAA |
| Internal bar code: | TCGCACGTAATAGTAATTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 853 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCGTTGTTGAGCGTCTTG |
| Suggested primer 2: | CACAGGACCTCAGCTCCAAG |