| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.006746 |
| Chromosome: | chromosome 3 |
| Location: | 5552441 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185250 | SSS2,SSII | (1 of 1) IPR001296//IPR011835//IPR013534//IPR015421 - Glycosyl transferase, family 1 // Bacterial/plant glycogen synthase // Starch synthase, catalytic domain // Pyridoxal phosphate-dependent transferase, major region, subdomain 1; Soluble starch synthase II | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCTACTCGGTCTTCAACTCCAACCAAGAGGTGCGCGGCGGACAGCTGG |
| Internal bar code: | GTTATTATAAAAGCATTGTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1660 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATGCGTGGAAGTAGCCCA |
| Suggested primer 2: | CGCTGGAGTCGGAGATGTAC |