Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.006754 |
Chromosome: | chromosome 1 |
Location: | 1356448 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g007050 | CPLD11 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PF11267 - Domain of unknown function (DUF3067) (DUF3067) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAAACCGTGGGGTTCCTGGGCTCCAGCGGCTGTGATGATAAGCGCTGT |
Internal bar code: | CAATGTGGAAGTTGGCATTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1621 |
LEAP-Seq percent confirming: | 7.97101 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 127 |
LEAP-Seq n unique pos: | 138 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATACGTAGGTGCGACAGGG |
Suggested primer 2: | GCAACGCCGTCATACACATC |