| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.006754 |
| Chromosome: | chromosome 1 |
| Location: | 1356469 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007050 | CPLD11 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PF11267 - Domain of unknown function (DUF3067) (DUF3067) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCAGAGGCCGGGCATCGGCACCCGCCGAGTGTTATGGCGTGGCTCG |
| Internal bar code: | CAATGTGGAAGTTGGCATTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1686 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACGCCGTCATACACATC |
| Suggested primer 2: | GATACGTAGGTGCGACAGGG |