| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006780 |
| Chromosome: | chromosome 13 |
| Location: | 2172583 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g577850 | FKB20,FKB20B,FKB20-2 | (1 of 1) PTHR10516:SF178 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP20-2, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCCCACGGGCGGCCCCAGGGCGGGCGGCACGATGATGCGCCGCTTG |
| Internal bar code: | TATGGGGCAAGCTCTCCGCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1813 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTCAGCTGTGTTTGGTG |
| Suggested primer 2: | TGATACATCTCGTGACGCCG |