| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.006788 |
| Chromosome: | chromosome 6 |
| Location: | 7718207 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302650 | RRM5 | (1 of 2) 2.1.1.166 - 23S rRNA (uridine(2552)-2'-O)-methyltransferase / Um2552 methyltransferase; Putative ribosomal RNA methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGAGCATCCGAGCGCACAACGTGGTCAGCACAATCACACTTGCTCCGA |
| Internal bar code: | GTCATTCTGCGGGTAGGCCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 333 |
| LEAP-Seq percent confirming: | 38.4615 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCGTTCATTTGTTCTGT |
| Suggested primer 2: | TGTGCATTGAAAGCCACAGC |