Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.006793 |
Chromosome: | chromosome 12 |
Location: | 8874106 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g546150 | PETM,PETM1 | Chloroplast cytochrome b6f PetM subunit; (1 of 1) PF08041 - PetM family of cytochrome b6f complex subunit 7 (PetM) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCAGCCTCGCCGGCAATCATGGCCAGCTCGTTCACGGCCTTGGTGGC |
Internal bar code: | AGGGGAAGTAGCTAAAGGTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 46 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACGGGAAGCGAAATAGCG |
Suggested primer 2: | TGCTGAGTGCTTCCTTGGAG |