| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.006797 |
| Chromosome: | chromosome 9 |
| Location: | 5773037 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410950 | NIA1,NIT1 | Nitrate reductase; (1 of 1) 1.6.2.2//1.7.1.1 - Cytochrome-b5 reductase // Nitrate reductase (NADH) / Nitrate reductase (NADH(2)) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGCCCGAGAGAGTGTGTGCACGTGCTAGTTTTGGAGTCAGGCACCGC |
| Internal bar code: | AAGGACAAGGTATAAAATATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2173 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 79 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCAGCTCTCCATGGTCCT |
| Suggested primer 2: | CGAACCAACCAACACCGAAC |