| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006809 |
| Chromosome: | chromosome 6 |
| Location: | 4185662 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278236 | UMM12 | (1 of 1) PTHR10108:SF871 - METHYLTRANSFERASE; Putative ubiquinone / menaquinone biosynthesis methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTTGAACCGTCGGCCTTCGGCAAATGTTGTGATGTGGTGGTGCGCGT |
| Internal bar code: | GAGTAGAACCTCAACTCTAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2463 |
| LEAP-Seq percent confirming: | 84.7222 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTGAACTCCATTGCGCT |
| Suggested primer 2: | CCGCGACTGTGTGTTTTGTT |