| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.006812 |
| Chromosome: | chromosome 10 |
| Location: | 2985372 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440450 | PSB28 | (1 of 1) K08903 - photosystem II 13kDa protein (psb28); Photosystem II associated subunit 28 | CDS |
| Cre10.g440500 | (1 of 5) PF12738 - twin BRCT domain (PTCB-BRCT) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCGTTGGCACCGGTGCGCGAGCGGGTCAGGCGCACCTCGGGAACCGT |
| Internal bar code: | GGAGGGGAAATCCTAGCAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4032 |
| LEAP-Seq percent confirming: | 80.303 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGTGACCGAGACCGTCTG |
| Suggested primer 2: | GTCACACACACCAACGCTTC |