| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006861 |
| Chromosome: | chromosome 9 |
| Location: | 5434177 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408550 | SAE1 | (1 of 1) K10684 - ubiquitin-like 1-activating enzyme E1 A (UBLE1A, SAE1); SUMO activating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCGCACACAGGCTTGGGCCGTTGGGAGTGTGCGGGGCGGCGGCGGCG |
| Internal bar code: | GTTGGGTGATTGCGCGAATGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 268 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGTGGGTCTGAGTGGGT |
| Suggested primer 2: | CCCTGGCAACTTCCTGGTAG |