| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006873 |
| Chromosome: | chromosome 11 |
| Location: | 1222535 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467689 | PETC1,PETC | (1 of 1) K02636 - cytochrome b6-f complex iron-sulfur subunit (petC); Chloroplast cytochrome b6f Rieske iron-sulfur center subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCCTTGTTGCGGCACTCGTGCCCATGTCGTGAGCTGTGTGTAAGCCAC |
| Internal bar code: | AAACGCTACATCGGCTCGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2319 |
| LEAP-Seq percent confirming: | 85.0746 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTACATGGCGCTGATGT |
| Suggested primer 2: | GTGGAGGAGATGACAAGGGC |