| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.006946 |
| Chromosome: | chromosome 12 |
| Location: | 2040741 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510400 | RBD4,CPLD30 | Conserved in the Plant Lineage and Diatoms; (1 of 4) IPR024934 - Rubredoxin-like domain | 3'UTR |
| Cre12.g801374 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAGTGCTCAATGCACGATGCCGCACAGTACGATCAAGGACTCCATGCA |
| Internal bar code: | TCTTCGGAGGAATCCTAATCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5543 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACCCTGCCATGCACTTTG |
| Suggested primer 2: | AGGCCCATATCCTCTGGTGT |